Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5869040
End position: 5869063
Length: 24

DNA sequence
>NC_021177, from 5869040 to 5869063 (24 bp); Streptomyces fulvissimus DSM 40593 GCCGCCACCGCCCCCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5868164-5869933	Sequence	SFUL_5295 - Rhs element Vgr protein (Protein is coded in complementary strand; from 5869933 to 5868164)