Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 586714
End position: 586740
Length: 27

DNA sequence
>NC_021177, from 586714 to 586740 (27 bp); Streptomyces fulvissimus DSM 40593 GAACGCGGCGATCGCGGCGAACCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 586139-587347	Sequence	SFUL_491 - Protein serine/threonine phosphatase (Protein is coded in complementary strand; from 587347 to 586139)