Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 585216
End position: 585242
Length: 27

DNA sequence
>NC_021177, from 585216 to 585242 (27 bp); Streptomyces fulvissimus DSM 40593 GGGGGTGGTGGGGGTGGCGGGCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 584467-585252	Sequence	SFUL_489 - 3-oxoacyl-(Acyl-carrier-protein) reductase (Protein is coded in complementary strand; from 585252 to 584467)