Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5843901
End position: 5843924
Length: 24

DNA sequence
>NC_021177, from 5843901 to 5843924 (24 bp); Streptomyces fulvissimus DSM 40593 GGACAGGGCCAGCGACAGGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5842738-5846052	Sequence	SFUL_5275 - ATPase-like protein (Protein is coded in complementary strand; from 5846052 to 5842738)