Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5791488
End position: 5791535
Length: 48

DNA sequence
>NC_021177, from 5791488 to 5791535 (48 bp); Streptomyces fulvissimus DSM 40593 GGTGCCGGCCGGGGTGTCTGCCGGGGAGCCGTCCGGGGTGTCGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5790124-5792190	Sequence	SFUL_5238 - Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase (Protein is coded in complementary strand; from 5792190 to 5790124)