Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5744317
End position: 5744340
Length: 24

DNA sequence
>NC_021177, from 5744317 to 5744340 (24 bp); Streptomyces fulvissimus DSM 40593 CGTCGTCATCGTCATCGTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5744151-5744879	Sequence	SFUL_5198 - Propeptide PepSY amd peptidase M4 (Protein is coded in complementary strand; from 5744879 to 5744151)