Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5697848
End position: 5697874
Length: 27

DNA sequence
>NC_021177, from 5697848 to 5697874 (27 bp); Streptomyces fulvissimus DSM 40593 GGCGAGCGCGGGGAGCGCCGCGAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5697210-5699264	Sequence	SFUL_5154 - Transcription termination factor Rho