Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5648728
End position: 5648781
Length: 54

DNA sequence
>NC_021177, from 5648728 to 5648781 (54 bp); Streptomyces fulvissimus DSM 40593 GCACCGCACCCGCAACAGGCACCGCACCCGCAACAGGCACCGCACACGACACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5645599-5648859	Sequence	SFUL_5112 - Integral membrane sensor signal transduction histidine kinase