Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5636388
End position: 5636432
Length: 45

DNA sequence
>NC_021177, from 5636388 to 5636432 (45 bp); Streptomyces fulvissimus DSM 40593 CTTGGCCTCGGCGGGCTTCGCCTCGGCCGGCTTGGCCTGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5632930-5636769	Sequence	SFUL_5103 - Alpha-ketoglutarate decarboxylase (Protein is coded in complementary strand; from 5636769 to 5632930)