Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5629689
End position: 5629712
Length: 24

DNA sequence
>NC_021177, from 5629689 to 5629712 (24 bp); Streptomyces fulvissimus DSM 40593 CCTTGCCCTTGTCCCTGCCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5629673-5630785	Sequence	SFUL_5099 - Transcriptional regulator, PadR-like family (Protein is coded in complementary strand; from 5630785 to 5629673)