Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5612096
End position: 5612119
Length: 24

DNA sequence
>NC_021177, from 5612096 to 5612119 (24 bp); Streptomyces fulvissimus DSM 40593 GTGGCGGTGGGGGTGGTGGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5612078-5613529	Sequence	SFUL_5080 - hypothetical protein (Protein is coded in complementary strand; from 5613529 to 5612078)