Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5582579
End position: 5582608
Length: 30

DNA sequence
>NC_021177, from 5582579 to 5582608 (30 bp); Streptomyces fulvissimus DSM 40593 CCTGATCCTGGTCATGATCCTGGTCCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5582236-5583096	Sequence	SFUL_5050 - Sugar ABC transporter permease protein