Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5518214
End position: 5518249
Length: 36

DNA sequence
>NC_021177, from 5518214 to 5518249 (36 bp); Streptomyces fulvissimus DSM 40593 CGGCACGCTTCTCGGCCTGCTTCTCGGCCTGCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5517172-5520096	Sequence	SFUL_4992 - Integral membrane protein (Protein is coded in complementary strand; from 5520096 to 5517172)