Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5515803
End position: 5515826
Length: 24

DNA sequence
>NC_021177, from 5515803 to 5515826 (24 bp); Streptomyces fulvissimus DSM 40593 GGTGGCGGTGGGGGAGGCGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5514352-5516001	Sequence	SFUL_4990 - TAP domain protein (Protein is coded in complementary strand; from 5516001 to 5514352)