Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5383455
End position: 5383478
Length: 24

DNA sequence
>NC_021177, from 5383455 to 5383478 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGGTGGAGGTGGCGGCCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5382778-5384925	Sequence	SFUL_4871 - Fibrillarin (Protein is coded in complementary strand; from 5384925 to 5382778)