Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 53708
End position: 53731
Length: 24

DNA sequence
>NC_021177, from 53708 to 53731 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGGCGGCGACGGTGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 52809-53834	Sequence	SFUL_52 - Aldo/keto reductase (Protein is coded in complementary strand; from 53834 to 52809)