Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5248165
End position: 5248189
Length: 25

DNA sequence
>NC_021177, from 5248165 to 5248189 (25 bp); Streptomyces fulvissimus DSM 40593 CGCGGCGCCGCGCCGGGCGGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5247473-5248441	Sequence	SFUL_4747 - Alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 5248441 to 5247473)