Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 519529
End position: 519573
Length: 45

DNA sequence
>NC_021177, from 519529 to 519573 (45 bp); Streptomyces fulvissimus DSM 40593 CATGTCCGCTGCGCTCATGTCCGCCCTGCTCATGTCTGCTCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 518447-519547	Sequence	SFUL_433 - Iron-siderophore permease transmembrane protein (Protein is coded in complementary strand; from 519547 to 518447)
ORF... 519574-520671	Sequence	SFUL_434 - Transport system permease protein (Protein is coded in complementary strand; from 520671 to 519574)