Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5128806
End position: 5128835
Length: 30

DNA sequence
>NC_021177, from 5128806 to 5128835 (30 bp); Streptomyces fulvissimus DSM 40593 CGGCGGAGGCGGAGGCGGAGGCGGCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5126090-5132533	Sequence	SFUL_4658 - Polyketide synthase type I (Protein is coded in complementary strand; from 5132533 to 5126090)