Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5124644
End position: 5124673
Length: 30

DNA sequence
>NC_021177, from 5124644 to 5124673 (30 bp); Streptomyces fulvissimus DSM 40593 TGGCGGTGGAGGTGGCGCTGCCGGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5124052-5125227	Sequence	SFUL_4656 - Acyl-CoA dehydrogenase type 2 domain protein (Protein is coded in complementary strand; from 5125227 to 5124052)