Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5111433
End position: 5111456
Length: 24

DNA sequence
>NC_021177, from 5111433 to 5111456 (24 bp); Streptomyces fulvissimus DSM 40593 GCTGCGGCGGCGGATGCGGCTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5111332-5111772	Sequence	SFUL_4643 - Integral membrane protein (Protein is coded in complementary strand; from 5111772 to 5111332)