Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5062318
End position: 5062347
Length: 30

DNA sequence
>NC_021177, from 5062318 to 5062347 (30 bp); Streptomyces fulvissimus DSM 40593 GTCAGGCCAGGTCGGGCCAGGTCAGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5062340-5064148	Sequence	SFUL_4602 - M23 family peptidase (Protein is coded in complementary strand; from 5064148 to 5062340)