Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5008451
End position: 5008480
Length: 30

DNA sequence
>NC_021177, from 5008451 to 5008480 (30 bp); Streptomyces fulvissimus DSM 40593 GGCCGGGGGCGGCGGGGTGCGGTCGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5007426-5009396	Sequence	SFUL_4559 - putative serine-threonine kinase-like protein (Protein is coded in complementary strand; from 5009396 to 5007426)