Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4980806
End position: 4980862
Length: 57

DNA sequence
>NC_021177, from 4980806 to 4980862 (57 bp); Streptomyces fulvissimus DSM 40593 TCGTAGACGTACGGAAGCTCCGTAGGCGTACGGAAGTTTCATGGACGTACGGAAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4980845-4981810	Sequence	SFUL_4526 - Integral membrane protein (Protein is coded in complementary strand; from 4981810 to 4980845)