Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 494674
End position: 494709
Length: 36

DNA sequence
>NC_021177, from 494674 to 494709 (36 bp); Streptomyces fulvissimus DSM 40593 GCCCCGCCCCTGCCCCCGCCCCTGCCCCCGCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 494656-496443	Sequence	SFUL_422 - Two-component sensor (Protein is coded in complementary strand; from 496443 to 494656)