Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 494618
End position: 494644
Length: 27

DNA sequence
>NC_021177, from 494618 to 494644 (27 bp); Streptomyces fulvissimus DSM 40593 AGCAGGAGAAGCAGGAGAAGCAGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 493931-494650	Sequence	SFUL_421 - LuxR family two-component response regulator