Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4942990
End position: 4943013
Length: 24

DNA sequence
>NC_021177, from 4942990 to 4943013 (24 bp); Streptomyces fulvissimus DSM 40593 CCCGGCCTCGGCACCGGCACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4942891-4943187	Sequence	SFUL_4471 - hypothetical protein (Protein is coded in complementary strand; from 4943187 to 4942891)