Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4932277
End position: 4932303
Length: 27

DNA sequence
>NC_021177, from 4932277 to 4932303 (27 bp); Streptomyces fulvissimus DSM 40593 GGGGGTGGTGGGGCTGGTGGGGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4932017-4933024	Sequence	SFUL_4461 - N-acetylmuramoyl-L-alanine amidase family 2 (Protein is coded in complementary strand; from 4933024 to 4932017)