Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4893156
End position: 4893180
Length: 25

DNA sequence
>NC_021177, from 4893156 to 4893180 (25 bp); Streptomyces fulvissimus DSM 40593 CGCCCGGCCCCGCTCCACCCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4892215-4893405	Sequence	SFUL_4417 - Integral membrane sensorsignal transduction histidine kinase (Protein is coded in complementary strand; from 4893405 to 4892215)