Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4883585
End position: 4883614
Length: 30

DNA sequence
>NC_021177, from 4883585 to 4883614 (30 bp); Streptomyces fulvissimus DSM 40593 CGGCGGTGGCGGCAGCGGTGGCGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4883515-4884567	Sequence	SFUL_4410 - RarD protein, DMT superfamily transporter (Protein is coded in complementary strand; from 4884567 to 4883515)