Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4883015
End position: 4883038
Length: 24

DNA sequence
>NC_021177, from 4883015 to 4883038 (24 bp); Streptomyces fulvissimus DSM 40593 CTGTGCCTGGGCCTGCGCCTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4882929-4883444	Sequence	SFUL_4409 - hypothetical protein (Protein is coded in complementary strand; from 4883444 to 4882929)