Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4828151
End position: 4828186
Length: 36

DNA sequence
>NC_021177, from 4828151 to 4828186 (36 bp); Streptomyces fulvissimus DSM 40593 GCCGGACCGGGAGCCGGAGCGGGAGCTGGAGCGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4827285-4828325	Sequence	SFUL_4353 - Membrane protein (Protein is coded in complementary strand; from 4828325 to 4827285)