Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4809275
End position: 4809298
Length: 24

DNA sequence
>NC_021177, from 4809275 to 4809298 (24 bp); Streptomyces fulvissimus DSM 40593 CCGAGCCCGAGCCCGAGCCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4809021-4809764	Sequence	SFUL_4335 - hypothetical protein (Protein is coded in complementary strand; from 4809764 to 4809021)