Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4801113
End position: 4801151
Length: 39

DNA sequence
>NC_021177, from 4801113 to 4801151 (39 bp); Streptomyces fulvissimus DSM 40593 CCCTCACCCCGCCCCCTCACCCCGCCCCCTCACCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4801143-4802318	Sequence	SFUL_4329 - Propanoyl-CoA C-acyltransferase (Protein is coded in complementary strand; from 4802318 to 4801143)