Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4786523
End position: 4786546
Length: 24

DNA sequence
>NC_021177, from 4786523 to 4786546 (24 bp); Streptomyces fulvissimus DSM 40593 AGGCGAAGGCCACGGCGAAGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4784743-4786971	Sequence	SFUL_4312 - Pimeloyl-CoA synthetase (Protein is coded in complementary strand; from 4786971 to 4784743)