Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4759869
End position: 4759904
Length: 36

DNA sequence
>NC_021177, from 4759869 to 4759904 (36 bp); Streptomyces fulvissimus DSM 40593 GCGGAGGTCGCGGGGGTCGCGGAGGTCGCGGAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4758759-4760228	Sequence	SFUL_4284 - putative immediate early protein (Protein is coded in complementary strand; from 4760228 to 4758759)