Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4735038
End position: 4735064
Length: 27

DNA sequence
>NC_021177, from 4735038 to 4735064 (27 bp); Streptomyces fulvissimus DSM 40593 GGCAGCTAGGTCAGCTAGGTCAGCTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4735062-4735700	Sequence	SFUL_4262 - Glyoxalase/bleomycin resistance protein/dioxygenase (Protein is coded in complementary strand; from 4735700 to 4735062)