Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4683943
End position: 4683966
Length: 24

DNA sequence
>NC_021177, from 4683943 to 4683966 (24 bp); Streptomyces fulvissimus DSM 40593 GCGACGGCGACGGCGGCGGTGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4683241-4684107	Sequence	SFUL_4212 - TetR family transcriptional regulatory protein (Protein is coded in complementary strand; from 4684107 to 4683241)