Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4631090
End position: 4631113
Length: 24

DNA sequence
>NC_021177, from 4631090 to 4631113 (24 bp); Streptomyces fulvissimus DSM 40593 GGCCGCCGCCGCGGCTGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4630554-4631261	Sequence	SFUL_4158 - Futalosine hydrolase (Protein is coded in complementary strand; from 4631261 to 4630554)