Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4626036
End position: 4626059
Length: 24

DNA sequence
>NC_021177, from 4626036 to 4626059 (24 bp); Streptomyces fulvissimus DSM 40593 GCGATGGCGAAGCCGATGCCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4625499-4626575	Sequence	SFUL_4151 - Iron-siderophore uptake system transmembrane component (Protein is coded in complementary strand; from 4626575 to 4625499)