Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4617091
End position: 4617132
Length: 42

DNA sequence
>NC_021177, from 4617091 to 4617132 (42 bp); Streptomyces fulvissimus DSM 40593 CCGCCCCTCCTTCTCCGCCCGTCCCTCTCCGCCCCTCCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4617133-4618776	Sequence	SFUL_4144 - DNA helicase (Protein is coded in complementary strand; from 4618776 to 4617133)