Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4613323
End position: 4613346
Length: 24

DNA sequence
>NC_021177, from 4613323 to 4613346 (24 bp); Streptomyces fulvissimus DSM 40593 GACGGTGGCGGTGGCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4611083-4613392	Sequence	SFUL_4140 - Lead, cadmium, zinc and mercury transporting ATPase ; Copper-translocating P-type ATPase (Protein is coded in complementary strand; from 4613392 to 4611083)