Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4596577
End position: 4596603
Length: 27

DNA sequence
>NC_021177, from 4596577 to 4596603 (27 bp); Streptomyces fulvissimus DSM 40593 CGGCTTCGGTGGCTTCGGTGGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4595583-4597433	Sequence	SFUL_4124 - Protein serine/threonine phosphatase with GAF(S)sensor(S) (Protein is coded in complementary strand; from 4597433 to 4595583)