Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4591483
End position: 4591506
Length: 24

DNA sequence
>NC_021177, from 4591483 to 4591506 (24 bp); Streptomyces fulvissimus DSM 40593 CGGATCCGGATCCTGATCCGGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4591506-4591859	Sequence	SFUL_4120 - hypothetical protein (Protein is coded in complementary strand; from 4591859 to 4591506)