Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4548056
End position: 4548082
Length: 27

DNA sequence
>NC_021177, from 4548056 to 4548082 (27 bp); Streptomyces fulvissimus DSM 40593 GTGGTGCGGGTGGTGCGCGTGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4546490-4548112	Sequence	SFUL_4079 - Preprometalloendoprotease (Protein is coded in complementary strand; from 4548112 to 4546490)