Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4529036
End position: 4529071
Length: 36

DNA sequence
>NC_021177, from 4529036 to 4529071 (36 bp); Streptomyces fulvissimus DSM 40593 GCCGCCGGTGCCGCCTCCGGTGCTGCTTCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4529027-4530505	Sequence	SFUL_4061 - Multidrug resistance transporter (Protein is coded in complementary strand; from 4530505 to 4529027)