Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4487480
End position: 4487503
Length: 24

DNA sequence
>NC_021177, from 4487480 to 4487503 (24 bp); Streptomyces fulvissimus DSM 40593 GCGTCCGCGCCCGCTTCCACGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4487339-4488472	Sequence	SFUL_4014 - DUF1006 domain containing protein (Protein is coded in complementary strand; from 4488472 to 4487339)