Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4452697
End position: 4452720
Length: 24

DNA sequence
>NC_021177, from 4452697 to 4452720 (24 bp); Streptomyces fulvissimus DSM 40593 GTGGCGGCGGCGGTGGCCGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4452563-4453354	Sequence	SFUL_3980 - tetR family transcriptional regulatory protein