Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4411440
End position: 4411463
Length: 24

DNA sequence
>NC_021177, from 4411440 to 4411463 (24 bp); Streptomyces fulvissimus DSM 40593 CGCTCCTGCTCCTGCTCCTGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4411317-4411784	Sequence	SFUL_3941 - ATP-binding region ATPase domain protein (Protein is coded in complementary strand; from 4411784 to 4411317)