Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4390016
End position: 4390039
Length: 24

DNA sequence
>NC_021177, from 4390016 to 4390039 (24 bp); Streptomyces fulvissimus DSM 40593 CGTTGCCGTTGCCGTCGCCGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4389667-4390101	Sequence	SFUL_3920 - NUDIX hydrolase (Protein is coded in complementary strand; from 4390101 to 4389667)